AmpliSAS - Amplicon Sequencing ASsignment tool

AmpliSAS accomplishes a full analysis of the data: de-multiplexation, clustering and filtering of variants (unique sequences) with genotyping purposes.

After running AmpliCHECK we should be able to establish the length of the desired PCR products (markers), the % of errors in variants and a threshold frequency to decide if a variant is real or is an artefact. Then we can run AmpliSAS to perform an exhaustive analysis and genotyping.

AmpliSAS workflow is divided into three main steps:

De-multiplexing of reads into amplicons and unique sequences based on matching of primers and tags sequences.
Clustering of amplicon sequences, where potential alleles and artefacts are grouped together based on user-defined thresholds.
Filtering of sequences based on user-defined parameters, like number of samples, frequency, depth, chimeras and frameshifts detection...

After an ideal analysis, artefacts will be removed and real variants will increase their coverages integrating sequencing errors being able to assign alleles to each amplicon. AmpliSAT is our best tested and recommended tool, but AmpliLEGACY offers the possibility to do a similar analysis using other genotyping strategies from the literature.

Click to enlarge

AmpliSAS takes as input:

SEQUENCE FILE: FASTQ or FASTA format file (compressed or uncompressed). Multiple sample/amplicon sequence files should be packed into a unique .ZIP or .TAR.GZ file. Also previously analyzed results can be used as input in AmpliSAS format Excel file.
AMPLICON DATA ¹: primer and tag information in a CSV format file as explained in the documentation.

¹ This file is not required if the 'Sequence File' already contains sample/amplicon files packed together (already de-multiplexed) or it is an Excel file in AmpliSAS format.

Results can be downloaded on the same page or from an email message after analysis completion.

For more information, read the documentation.

Run AmpliSAS

Run name:
Email (optional):

Sequence file:	FASTA/FASTQ (compressed or uncompressed) without spaces, parenthesis or other special symbols in the name If reads have been already de-multiplexed into separate files (one file per sample), you can pack them into a single .zip or .tar.gz format file and use it as input. In such case you should leave empty the amplicon data section. Max. 500 MB Download example Or file URL:

Technology:	Auto Illumina 454/IonTorrent Analysis parameters will be optimized for the selected sequencing technology, they can be modified in "Advanced options". If transcriptomic data is being analyzed or many co-amplifying alleles are expected (>10, e.g. MHC class I), the 'minimum per amplicon frequency' threshold in 'Advanced program parameters' section should be manually adjusted.

Maximum number of alleles per amplicon:	Maximum number of expected alleles per amplicon, it will limit the number of clusters to calculate and also this number will be used for Degree of Change calculations in case this filtering option is chosen.
Minimum amplicon depth:	Amplicons with lower total coverage will be discarded.

Amplicon data:	It is very important to specify all the primer and tag sequences in 5'->3' sense. Shortening primer sequences to 7-9 nts can increase the number of retrieved sequences (eg. GAGTGTCAT instead of GAGTGTCATTTCTCCAACGGGA). >marker,primer_f,primer_r,gene,feature,species MHC2,GAGTGTCATTTCTCCAACGGGA,TCACCTCTCCKCTCCACAGTGAA,DRB MHC2,exon 2,Spermophilus suslicus >sample,tag_f,tag_r S1,AACGCG,AAGACA S2,TCACTC,CGTCAC S3,CTTGGT,TTGAGT S4,TGGAAC,TAACAT S5,CGAATC,GGTCGA or file: Max. 100 KB See example
Alleles file (optional):	FASTA format Max. 2 MB See example
Additional options:

Only de-multiplexing:	If selected this option, sequences/reads will be de-multiplexed into amplicons (very fast, clustering and filtering steps will be skipped).
Skip clustering:	If selected this option, clustering step will be skipped and clustering parameters will be ignored.
Skip filtering:	If selected this option, filtering step will be skipped and filtering parameters will be ignored.
Verbose mode:	All sequences clustered and/or filtered will be printed into individual files explaining the clustering/filtering reasons.
Maximum number of reads per amplicon:	Maximum number of amplicon sequences/reads to be processed.

Advanced program parameters


Clustering parameters:
Leave in blank if you don't want to use the parameter.

Substitution errors (%):	%. Sequences with higher number of substitutions will be classified into new clusters (substitutions = errors x length).
Indel errors (%):	%. Sequences with higher number of non-homopolymer indels will be classified into new clusters (indels = errors x length).
Clustering identity threshold (%):	%. Sequences with lower identity will be classified into new clusters.
Minimum dominant frequency (%):	%. Sequences within a cluster with same or higher frequency respect to the dominant will be classified as 'subdominants' and moved to a new cluster.
Minimum amplicon frequency (%):	%. Sequences with same or higher frequency within the same amplicon will be classified as 'subdominants' and moved to a new cluster.
Exact length required:	Only sequences that satisfy theoretical marker lengths can be 'dominant' within a cluster.
In-frame length required:	Only sequences in-frame with marker theoretical lengths can be 'dominant' within a cluster.
Keep singletons:	Keep singletons (OTUs with coverage 1) after clustering.
Cluster correction with alleles:	Sequences given in the allele file will be used to correct 'dominant' ones within clusters.
Filtering parameters:
Leave in blank if you don't want to apply the filter.
Minimum variant depth:	Sequences with lower coverage will be discarded.
Minimum amplicon frequency (%):	%. Sequences with lower frequency will be discarded.
Maximum amplicon length deviation:	Sequences longer or shorter than the marker theoretical lengths±value will be discarded.
Discard chimeras:	Sequences that are chimeras from other major sequences will be discarded.
Discard noncoding:	Sequences with stop codons in major reading frame will be discarded.
Discard frameshifts:	Sequences not in-frame with marker theoretical lengths will be discarded.
Commonness:	Samples: Frequency: %. Sequences present in an equal or higher number of samples will be kept, if they pass the minimum specified frequency, even if they do not pass other filters.
Degree of Change (DOC):	If DOC option is chosen, all other filters will be ignored. Remember to adjust the parameter 'Maximum number of alleles per amplicon' above.

Disclaimer

Your use of any of these tools is at your own risk. We do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. By visiting the site, you accept our use of cookies and you accept that your data and results will be stored in our server.